Biochemistry
This is an excerpt from the paper...
Qu. 1 Koch's postulates are a set of criteria for determining whether a given bacteria is the cause of a given disease (KochÆs, 2004). They were formulated in 1860 by a German physician and bacteriologist, Robert Koch. There are four KochÆs postulates: 1) The bacteria must be present in every case of the disease 2) The bacteria must be isolated from the host with the disease and grown in pure culture 3) The specific disease must be reproduced when a pure culture of the bacteria is inoculated into a healthy susceptible host 4) The bacteria must be recoverable from the experimentally infected host. There are some exceptions to these four postulates, such as: a) It may not be possible to grow the particular bacteria in pure culture in the laboratory, e.g. M. leprae b) There is no animal model of infection with the particular bacteria. Also, a harmless bacteria may cause disease in certain circumstances, such as if: a) It has acquired extra virulence factors making it pathogenic b) It gains access to deep tissue via trauma, surgery, and IV line, etc. c) It infects an immunocompromised patient d) Not all people infected by a bacteria may develop disease-subclinical infection is usually more common than Qu. 2 DNA code = TACTTACCGAGATTCTTGTTTATC mRNA CODE = AUGAAUGGCUCUAAGAACAAAUAG aa sequence = MetAsnGlySerLysAsnLysStop (Devlin, 1997, 718)
. . .
Some common words found in the essay are:
MetAsnGlySerLysAsnLysStop Devlin, AMP Qu, Koch KochÆs, DNA Primers, Wiley-Liss Hydrogen, , UAA UGA, dna polymerase, devlin 1997, amino acid, 2004 retrieved, pcr process, polymerase 2004, hydrogen peroxide, thermus aquaticus, pure culture, dna template, References Devlin, polymerase chain reaction, bacteria cause disease,
Approximate Word count = 1156
Approximate Pages = 5 (250 words per page)
|